Top » Catalog » R1b » A805

$18.00

A805
[A805]

A805
hg38 Position: ChrY:20652589..20652589
Ancestral: T
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a1
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A805_F TGCCAAAGTTAAGAAAACCTTATTTC
Reverse Primer: A805_R GCTTGTTGGGTAAAAGGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies