Top » Catalog » R1b » A805

$18.00

A805
[A805]

A805
hg38 Position: ChrY:20652589..20652589
Ancestral: T
Derived: A
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b4a1
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A805_F TGCCAAAGTTAAGAAAACCTTATTTC
Reverse Primer: A805_R GCTTGTTGGGTAAAAGGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2149
1 x A55
1 x A605
1 x A1494
1 x A1081
1 x A1159
1 x A461
1 x A742
1 x A996
1 x A750
1 x A542
1 x A208
1 x A1097
1 x A744
1 x A888
1 x A729
1 x A1002
1 x A1166
1 x A1012
1 x A630
1 x A513
1 x A1074
$396.00
Haplogroup Info
Other products
Currencies