Top » Catalog » R1b » A806

$18.00

A806
[A806]

A806
hg38 Position: ChrY:7723084..7723084
Ancestral: T
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b5
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A806_F AGTTCTTAAGCAATCAATAATCACCA
Reverse Primer: A806_R AACATTGTGAGGTACTGAAATTTGG
Reviews

Customers who bought this product also purchased
S1115
S1115
BY2880
BY2880
FGC29290
FGC29290
A1511
A1511
A804
A804
A150
A150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies