Top » Catalog » R1b » A807

$18.00

A807
[A807]

A807
hg38 Position: ChrY:12975881..12975881
Ancestral: A
Derived: G
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b5
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A807_F CCCCCAAACTTGTCTTTCTG
Reverse Primer: A807_R AACCAGACTGGGACAAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1292
$18.00
Haplogroup Info
Other products
Currencies