Top » Catalog » R1b » A809

$18.00

A809
[A809]

A809
hg38 Position: ChrY:15098692..15098692
Ancestral: A
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b5
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A809_F GTGGACCTATGGGACAATGG
Reverse Primer: A809_R GGACTCGCTTCACACAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A582
$18.00
Haplogroup Info
Other products
Currencies