Top » Catalog » R1b » A810

$18.00

A810
[A810]

A810
hg38 Position: ChrY:20838237..20838237
Ancestral: C
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b5
Comments: Found in CTS4466 individuals downstream of S1121
Forward Primer: A810_F CCCTTTCTCTCATCTTCAACAAG
Reverse Primer: A810_R TGGCTTACAGAAGGAATTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2154
1 x A1489
1 x A2269
$54.00
Haplogroup Info
Other products
Currencies