Top » Catalog » R1b » A1732

$18.00

A1732
[A1732]

A1732
hg38 Position: ChrY:14531078..14531078
Ancestral: C
Derived: G
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1732_F GCTTCAGAAACCCAGCATTG
Reverse Primer: A1732_R CTGCAAATAAAACTATTTTGTCCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A912
$18.00
Haplogroup Info
Other products
Currencies