Top » Catalog » R1b » A818

$18.00

A818
[A818]

A818
hg38 Position: ChrY:15832423..15832423
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Downstream or equivalent L1402
Forward Primer: A818v2_F TTCAATATCAGCCATATACATACATAGG
Reverse Primer: A818v2_R TTTCATTATTTGCCTTATTGCG
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
L1403
L1403
A421
A421
Z3004
Z3004
L1402
L1402
A418
A418
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A6
1 x A338
$36.00
Haplogroup Info
Other products
Currencies