Top » Catalog » R1b » A819

$18.00

A819
[A819]

A819
hg38 Position: ChrY:20703363..20703363
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Downstream or equivalent L1402
Forward Primer: A819_F GAACAATGAAGAATGACAACGTG
Reverse Primer: A819_R TGACACCCAGACTTGAATGC
Reviews

Customers who bought this product also purchased
A818
A818
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies