Top » Catalog » R1b » A819

$18.00

A819
[A819]

A819
hg38 Position: ChrY:20703363..20703363
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1a3a (not listed)
Comments: Downstream or equivalent L1402
Forward Primer: A819_F GAACAATGAAGAATGACAACGTG
Reverse Primer: A819_R TGACACCCAGACTTGAATGC
Reviews

Customers who bought this product also purchased
A818
A818
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
1 x A1327
1 x A2163
1 x A127
1 x A1787
1 x A1285
1 x A802
1 x A70
1 x A2145
1 x A990
1 x A97
1 x A552
1 x A425
1 x A787
1 x A68
1 x A2120
1 x A614
1 x A117
$324.00
Haplogroup Info
Other products
Currencies