Top » Catalog » R1b » A823

$18.00

A823
[A823]

A823
hg38 Position: ChrY:13191735..13191735
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A223
Forward Primer: A823_F TCATTCAACACATGTCTAAAATTCC
Reverse Primer: A823_R GCACAATCTCACCTCACTGC
Reviews

Customers who bought this product also purchased
A223
A223
A743
A743
A822
A822
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2141
1 x A573
1 x A58
1 x A2258
$72.00
Haplogroup Info
Other products
Currencies