Top » Catalog » R1b » A624

$18.00

A624
[A624]

A624
hg38 Position: ChrY:12225368..12225368
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A624_F CACTGCTAAGAATGAGGACGAC
Reverse Primer: A624_R GAGTGACAGAGAGGGGAATTTAG
Reviews

Customers who bought this product also purchased
A612
A612
A611
A611
A610
A610
A631
A631
A630
A630
A629
A629
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A450
$18.00
Haplogroup Info
Other products
Currencies