Top » Catalog » R1b » A628

$18.00

A628
[A628]

A628
hg38 Position: ChrY:14680377..14680377
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Aka FGC19613. downstream of CTS6889 / CTS11824
Forward Primer: A628_F GGCATATTGTTCCAGGTTTCC
Reverse Primer: A628_R AGCTTCATTACACAAGAGAATAGGATAC
Reviews

Customers who bought this product also purchased
A610
A610
A631
A631
A630
A630
A629
A629
A612
A612
A611
A611
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies