Top » Catalog » R1b » A854

$18.00

A854
[A854]

A854
hg38 Position: ChrY:17445798..17445798
Ancestral: A
Derived: G
Reference: Les Tate (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2 (not listed)
Comments: Downstream of S691
Forward Primer: A854_F GGTGTGGGACTCATTGAGAG
Reverse Primer: A854_R AAGAATAATTGAAACAACCACAGG
Reviews

Customers who bought this product also purchased
A5291
A5291
FGC19633
FGC19633
S764
S764
S7362
S7362
S744
S744
S7361
S7361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2181
$18.00
Haplogroup Info
Other products
Currencies