Top » Catalog » R1b » A854

$18.00

A854
[A854]

A854
hg38 Position: ChrY:17445798..17445798
Ancestral: A
Derived: G
Reference: Les Tate (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2 (not listed)
Comments: Downstream of S691
Forward Primer: A854_F GGTGTGGGACTCATTGAGAG
Reverse Primer: A854_R AAGAATAATTGAAACAACCACAGG
Reviews

Customers who bought this product also purchased
A5291
A5291
FGC19633
FGC19633
S695
S695
CTS4554
CTS4554
S691
S691
A859
A859
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies