Top » Catalog » R1b » A858

$18.00

A858
[A858]

A858
hg38 Position: ChrY:17106709..17106709
Ancestral: A
Derived: C
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Downstream L1335 (X L1065)
Forward Primer: A858_F TTCCACAGCAGTTGCATCAC
Reverse Primer: A858_R ATGGGCCACACGTTATCTTC
Reviews

Customers who bought this product also purchased
S691
S691
S764
S764
S744
S744
L1065
L1065
L1335
L1335
A23988
A23988
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
$18.00
Haplogroup Info
Other products
Currencies