Top » Catalog » R1b » A858

$18.00

A858
[A858]

A858
hg38 Position: ChrY:17106709..17106709
Ancestral: A
Derived: C
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Downstream L1335 (X L1065)
Forward Primer: A858_F TTCCACAGCAGTTGCATCAC
Reverse Primer: A858_R ATGGGCCACACGTTATCTTC
Reviews

Customers who bought this product also purchased
S691
S691
S764
S764
S744
S744
A23988
A23988
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
BY156842
BY156842
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies