Top » Catalog » R1b » A859

$18.00

A859
[A859]

A859
hg38 Position: ChrY:19529061..19529061
Ancestral: G
Derived: A
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2
Comments: Downstream A854
Forward Primer: A859_F AAGGAGATCCCCATCAGACTC
Reverse Primer: A859_R CCCTCTCATTGTTTATCATTGC
Reviews

Customers who bought this product also purchased
S764
S764
S7362
S7362
S744
S744
S7361
S7361
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
S690
S690
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A59
$18.00
Haplogroup Info
Other products
Currencies