Top » Catalog » R1b » A859

$18.00

A859
[A859]

A859
hg38 Position: ChrY:19529061..19529061
Ancestral: G
Derived: A
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a2
Comments: Downstream A854
Forward Primer: A859_F AAGGAGATCCCCATCAGACTC
Reverse Primer: A859_R CCCTCTCATTGTTTATCATTGC
Reviews

Customers who bought this product also purchased
S695
S695
CTS4554
CTS4554
S691
S691
A854
A854
S764
S764
S7362
S7362
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
$54.00
Haplogroup Info
Other products
Currencies