Top » Catalog » R1b » A861

$18.00

A861
[A861]

A861
hg38 Position: ChrY:9923810..9923810
Ancestral: A
Derived: G
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a1 (not listed)
Comments: Downstream of L1065 S764
Forward Primer: A861_F CATGCACATCCTTTGATTGG
Reverse Primer: A861_R GATGGAGACAGGCTGTGGAC
Reviews

Customers who bought this product also purchased
FGC32994
FGC32994
S9767
S9767
FGC45280
FGC45280
BY154
BY154
BY150
BY150
S695
S695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2184
1 x A1332
1 x A2248
1 x A1338
1 x A2195
1 x A880
$108.00
Haplogroup Info
Other products
Currencies