Top » Catalog » R1b » A874

$18.00

A874
[A874]

A874
hg38 Position: ChrY:7728682..7728682
Ancestral: T
Derived: C
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4
Comments: Below DF41
Forward Primer: A874_F CAAATGAATGGCTCTATTTCTGC
Reverse Primer: A874_R CAGTCATTTCCTGCGAGTAAGG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
BY23827
BY23827
YSEQ-Alpha
YSEQ-Alpha
A9365
A9365
A98
A98
FGC13023
FGC13023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
$72.00
Haplogroup Info
Other products
Currencies