Top » Catalog » R1b » A874

$18.00

A874
[A874]

A874
hg38 Position: ChrY:7728682..7728682
Ancestral: T
Derived: C
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4
Comments: Below DF41
Forward Primer: A874_F CAAATGAATGGCTCTATTTCTGC
Reverse Primer: A874_R CAGTCATTTCCTGCGAGTAAGG
Reviews

Customers who bought this product also purchased
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
DF49
DF49
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A426
1 x A720
$36.00
Haplogroup Info
Other products
Currencies