Top » Catalog » R1b » A875

$18.00

A875
[A875]

A875
hg38 Position: ChrY:9000934..9000934
Ancestral: G
Derived: T
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4~
Comments: Below DF41
Forward Primer: A875_F CCTATCAAGGGTGGAAATCG
Reverse Primer: A875_R CAACTGCAAGACCCTAAACATG
Reviews

Customers who bought this product also purchased
DF41
DF41
A40
A40
DF13
DF13
Z18021
Z18021
Z255
Z255
S775
S775
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A640
1 x A1230
1 x A2159
1 x A1499
1 x A238
1 x A1753
1 x A1490
1 x A534
1 x A1064
1 x A494
1 x A588
1 x A772
1 x A739
1 x A1746
$252.00
Haplogroup Info
Other products
Currencies