Top » Catalog » R1b » A875

$18.00

A875
[A875]

A875
hg38 Position: ChrY:9000934..9000934
Ancestral: G
Derived: T
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4~
Comments: Below DF41
Forward Primer: A875_F CCTATCAAGGGTGGAAATCG
Reverse Primer: A875_R CAACTGCAAGACCCTAAACATG
Reviews

Customers who bought this product also purchased
DF13
DF13
Z18021
Z18021
Z255
Z255
S775
S775
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
MC21
MC21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies