Top » Catalog » R1b » A876

$18.00

A876
[A876]

A876
hg38 Position: ChrY:14535908..14535908
Ancestral: T
Derived: C
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4~
Comments: Below DF41
Forward Primer: A876_F AAATTGCAGCTTGAAACTAGCC
Reverse Primer: A876_R GGATCTGACTAGATTAAATGCCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies