Top » Catalog » R1b » A876

$18.00

A876
[A876]

A876
hg38 Position: ChrY:14535908..14535908
Ancestral: T
Derived: C
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i4~
Comments: Below DF41
Forward Primer: A876_F AAATTGCAGCTTGAAACTAGCC
Reverse Primer: A876_R GGATCTGACTAGATTAAATGCCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A306
1 x A1773
1 x A187
1 x A551
1 x A95
1 x A1322
1 x A410
1 x A975
1 x A135
1 x A359
1 x A510
1 x A337
1 x A629
1 x A467
1 x A1165
1 x A1161
1 x A462
$306.00
Haplogroup Info
Other products
Currencies