Top » Catalog » R1b » A1201

$18.00

A1201
[A1201]

A1201
hg38 Position: ChrY:20387799..20387799
Ancestral: A
Derived: G
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream CTS3937
Forward Primer: A1201_F GCACAGGGATGAAGATGATG
Reverse Primer: A1201_R AGCCACCACTTATGGCCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
1 x A1164
1 x A682
1 x A636
1 x A326
1 x A190
$180.00
Haplogroup Info
Other products
Currencies