Top » Catalog » R1b » A883

$18.00

A883
[A883]

A883
hg38 Position: ChrY:17084316..17084316
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A259
Forward Primer: A883_F AAGAGCAGCACACGCTTTC
Reverse Primer: A883_R CAGAAAGTGAGCTGCACAGG
Reviews

Customers who bought this product also purchased
A11846
A11846
BY38367
BY38367
A18727
A18727
Y160254
Y160254
A21190
A21190
V86
V86
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1097
$18.00
Haplogroup Info
Other products
Currencies