Top » Catalog » R1b » A883

$18.00

A883
[A883]

A883
hg38 Position: ChrY:17084316..17084316
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A259
Forward Primer: A883_F AAGAGCAGCACACGCTTTC
Reverse Primer: A883_R CAGAAAGTGAGCTGCACAGG
Reviews

Customers who bought this product also purchased
BY18113
BY18113
Y96121
Y96121
Y132143
Y132143
BY38367
BY38367
FGC59201
FGC59201
S1051
S1051
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A663
1 x A418
1 x A1010
1 x A791
1 x A558
1 x A1231
$108.00
Haplogroup Info
Other products
Currencies