Top » Catalog » R1b » A884

$18.00

A884
[A884]

A884
hg38 Position: ChrY:7394654..7394654
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A259
Forward Primer: A884_F GCTGTCCACCCTACAAAAGG
Reverse Primer: A884_R CAGAAAGGTCCACTGCTGAG
Reviews

Customers who bought this product also purchased
A886
A886
A885
A885
A883
A883
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
$54.00
Haplogroup Info
Other products
Currencies