Top » Catalog » R1b » A885

$19.00

A885
[A885]

A885
hg38 Position: ChrY:8680802..8680802
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A259
Forward Primer: A885_F TAGAGGTCACATCCCACCAG
Reverse Primer: A885_R GGGCCCATTGAATTTACCTC
Reviews

Customers who bought this product also purchased
A886
A886
A884
A884
A883
A883
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies