Top » Catalog » R1b » A887

$18.00

A887
[A887]

A887
hg38 Position: ChrY:15809823..15809823
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream A259
Forward Primer: A887_F ACCACATTCATTAAGGACAGTGTG
Reverse Primer: A887_R GATAGAAGCTAGAGAGGCTGATAAGC
Reviews

Customers who bought this product also purchased
Z2980
Z2980
A883
A883
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
S673
S673
S588
S588
A224
A224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1075
1 x A58
$36.00
Haplogroup Info
Other products
Currencies