Top » Catalog » R1b » A882

$18.00

A882
[A882]

A882
hg38 Position: ChrY:26606647..26606647
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A882v2_F CAGAGATATAGATCAATCGAACAGAATG
Reverse Primer: A882v2_R TTTGTTTGAGATCATTATAGATTCTGC
Reviews

Customers who bought this product also purchased
A8818
A8818
A17987
A17987
A17986
A17986
A877
A877
A880
A880
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A789
1 x A432
1 x A120
1 x A545
1 x A734
1 x A662
1 x A245
1 x A96
1 x A1260
1 x A503
1 x A477
1 x A1266
1 x A767
$234.00
Haplogroup Info
Other products
Currencies