Top » Catalog » R1b » A889

$18.00

A889
[A889]

A889
hg38 Position: ChrY:18644682..18644682
Ancestral: A
Derived: G
Reference: Hereld Stuart (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream of L746 > S781
Forward Primer: A889v2_F CTCCACCTAGGTTGACTCCATG
Reverse Primer: A889v2_R CTTTCTCTAAACAACATGAAAATGG
Reviews

Customers who bought this product also purchased
S310
S310
A5023
A5023
A40
A40
S775
S775
S781
S781
L746
L746
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A470
$18.00
Haplogroup Info
Other products
Currencies