Top » Catalog » R1b » A614

$18.00

A614
[A614]

A614
hg38 Position: ChrY:8979323..8979323
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A614_F GCAAGAAGAATTGATGGCAC
Reverse Primer: A614_R TCAGGAAAGATTCATACATGATATTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies