Top » Catalog » R1b » A100

$19.00

A100
[A100]

A100
hg38 Position: ChrY:11912037..11912037
Ancestral: A
Derived: T
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i6
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A100_F TAGCTAGTCTGATTGGAATAAGAAGATATGTA
Reverse Primer: A100_R GGCAGGTTTTTCATTACTGCC
Reviews

Customers who bought this product also purchased
A10023
A10023
A10022
A10022
A1
A1
A16874
A16874
A16873
A16873
A16867
A16867
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies