Top » Catalog » R1b » A100

$17.50

A100
[A100]

A100
HG19 Position: ChrY:14032743..14032743
Ancestral: A
Derived: T
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1 (not listed)
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A100_F TAGCTAGTCTGATTGGAATAAGAAGATATGTA
Reverse Primer: A100_R GGCAGGTTTTTCATTACTGCC
Reviews

Customers who bought this product also purchased
Z251
Z251
DF13
DF13
Z255
Z255
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
FGC11134
FGC11134
L513
L513
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies