Top » Catalog » R1b » A926

$18.00

A926
[A926]

A926
hg38 Position: ChrY:12034400..12034400
Ancestral: C
Derived: A
Reference: Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A926_F GCTACAGACCTAAGTTCACTTCGG
Reverse Primer: A926_R TGGGCTAAATGCACCAACTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1237
1 x A1781
1 x A2138
1 x A2247
1 x A1192
1 x A365
1 x A699
1 x A646
1 x A955
1 x A2134
1 x A674
1 x A2122
1 x A179
1 x A1336
1 x A1771
$270.00
Haplogroup Info
Other products
Currencies