Top » Catalog » R1b » A927

$18.00

A927
[A927]

A927
hg38 Position: ChrY:14354820..14354820
Ancestral: C
Derived: A
Reference: Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A927_F TCCAGGAGGAAATCAATTCTG
Reverse Primer: A927_R CCAACAAGGACAGGTGAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2149
1 x A55
1 x A605
1 x A1494
1 x A1081
1 x A1159
1 x A461
1 x A742
1 x A996
1 x A750
1 x A542
1 x A208
1 x A1097
1 x A744
1 x A888
1 x A729
1 x A1002
$306.00
Haplogroup Info
Other products
Currencies