Top » Catalog » R1b » A928

$18.00

A928
[A928]

A928
hg38 Position: ChrY:14506651..14506651
Ancestral: C
Derived: A
Reference: Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A928_F GAAGCTTTGTTCCTTTGCTCC
Reverse Primer: A928_R ACGGTCCCAACTCTGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A389
1 x A104
$36.00
Haplogroup Info
Other products
Currencies