Top » Catalog » R1b » A928

$18.00

A928
[A928]

A928
hg38 Position: ChrY:14506651..14506651
Ancestral: C
Derived: A
Reference: Ramelet-Stuart (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A928_F GAAGCTTTGTTCCTTTGCTCC
Reverse Primer: A928_R ACGGTCCCAACTCTGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A687
1 x A1343
1 x A1504
1 x A807
1 x A593
1 x A564
1 x A2233
1 x A340
1 x A1265
1 x A1191
1 x A420
1 x A735
1 x A172
1 x A508
1 x A2223
1 x A235
1 x A59
1 x A385
1 x A1290
1 x A661
1 x A2225
1 x A1242
$396.00
Haplogroup Info
Other products
Currencies