Top » Catalog » R1b » A920

$19.00

A920
[A920]

A920
hg38 Position: ChrY:16981533..16981533
Ancestral: C
Derived: T
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i1a (not listed)
Comments: Downstream S781
Forward Primer: A920_F AGCAACTGGGTTTGGATGAC
Reverse Primer: A920_R TGCTGTTATTCTCCCCTTTG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies