Top » Catalog » R1b » A435

$18.00

A435
[A435]

A435
hg38 Position: ChrY:8281430..8281430
Ancestral: G
Derived: T
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A435_F AGAGACAGAGGACCACTAAGTGG
Reverse Primer: A435_R TGGCTGAGTTTCTTTCCCTATC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies