Top » Catalog » R1b » A436

$18.00

A436
[A436]

A436
hg38 Position: ChrY:8700064..8700064
Ancestral: A
Derived: G
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A436_F GGTATGAAAGACCTTAAAATGGC
Reverse Primer: A436_R AGGGAGAGTCCAACACAAGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A431
A431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1737
1 x A725
1 x A1262
1 x A423
1 x A240
1 x A104
1 x A2200
1 x A1185
1 x A1341
$162.00
Haplogroup Info
Other products
Currencies