Top » Catalog » R1b » A442

$18.00

A442
[A442]

A442
hg38 Position: ChrY:12993679..12993679
Ancestral: G
Derived: A
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A442_F GTTGACCTCGTCCTTTCCAG
Reverse Primer: A442_R GGATGCAAGGATGTTTCGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A5579
A5579
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies