Top » Catalog » R1b » A443

$18.00

A443
[A443]

A443
hg38 Position: ChrY:13714675..13714675
Ancestral: A
Derived: G
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A443_F TCATTTGGCTCCCAAGTAGC
Reverse Primer: A443_R AGGTGAACCAGGAGAAAATCC
Reviews

Customers who bought this product also purchased
A10951
A10951
A455
A455
A438
A438
A790
A790
A433
A433
A5581
A5581
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A359
1 x A571
1 x A2204
1 x A1126
1 x A603
$90.00
Haplogroup Info
Other products
Currencies