Top » Catalog » R1b » A443

$18.00

A443
[A443]

A443
hg38 Position: ChrY:13714675..13714675
Ancestral: A
Derived: G
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A443_F TCATTTGGCTCCCAAGTAGC
Reverse Primer: A443_R AGGTGAACCAGGAGAAAATCC
Reviews

Customers who bought this product also purchased
A10951
A10951
A455
A455
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A5579
A5579
A788
A788
A446
A446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies