Top » Catalog » R1b » A444

$18.00

A444
[A444]

A444
hg38 Position: ChrY:15025987..15025987
Ancestral: C
Derived: G
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A444_F CCCAGGACTAAACATGGAATATG
Reverse Primer: A444_R TGAAGAGGGCTCATAACACTAGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A455
A455
A10951
A10951
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A336
1 x A2078
$36.00
Haplogroup Info
Other products
Currencies