Top » Catalog » R1b » A445

$18.00

A445
[A445]

A445
hg38 Position: ChrY:15077944..15077944
Ancestral: T
Derived: C
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A445_F AAAGGAAGCAGAATTTATCATTGG
Reverse Primer: A445_R AATGGCAGGAACATCTAAAAGTATG
Reviews

Customers who bought this product also purchased
A10951
A10951
A455
A455
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A5579
A5579
A788
A788
A446
A446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies