Top » Catalog » R1b » A447

$18.00

A447
[A447]

A447
hg38 Position: ChrY:16458365..16458365
Ancestral: G
Derived: T
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A447_F TTGTCATTGCTTCCATTTCTTG
Reverse Primer: A447_R AAAAGACAGCAGGGCATCAG
Reviews

Customers who bought this product also purchased
Y15850
Y15850
A787
A787
Wish a SNP
Wish a SNP
A10951
A10951
A455
A455
A438
A438
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A634
1 x A2080
1 x A889
1 x A424
1 x A125
1 x A719
1 x A2076
1 x A793
1 x A997
1 x A348
1 x A758
1 x A2207
1 x A964
$234.00
Haplogroup Info
Other products
Currencies