Top » Catalog » R1b » A449

$18.00

A449
[A449]

A449
hg38 Position: ChrY:16630117..16630117
Ancestral: G
Derived: T
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A449_F AAATCCTCAGTTTGAAACACCTG
Reverse Primer: A449_R CTCCCAAAGTACTGGGATTACAG
Reviews

Customers who bought this product also purchased
A787
A787
Wish a SNP
Wish a SNP
Y15850
Y15850
A10951
A10951
A455
A455
A433
A433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1327
1 x A88
1 x A2131
$54.00
Haplogroup Info
Other products
Currencies