Top » Catalog » R1b » A450

$18.00

A450
[A450]

A450
hg38 Position: ChrY:16636160..16636160
Ancestral: C
Derived: T
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A450_F GACAAAGCACTGTGATTACTTGG
Reverse Primer: A450_R TCTGTTTCACTCTGAATATTGGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A5581
A5581
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1286
$18.00
Haplogroup Info
Other products
Currencies