Top » Catalog » R1b » A451

$18.00

A451
[A451]

A451
hg38 Position: ChrY:19755449..19755449
Ancestral: G
Derived: T
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A451v2_F CCCTGGTCAGTTTTGTTTGC
Reverse Primer: A451v2_R CTAAGGCCTTGGGTTTCATG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A788
A788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A980
1 x A530
1 x A274
1 x A1263
$72.00
Haplogroup Info
Other products
Currencies